Programming language shootout: fasta
From Gambit wiki
(Difference between revisions)
(Fasta benchmark with buffered output) |
(correct link to alioth) |
||
Line 1: | Line 1: | ||
- | This is a Gambit implementation of the [http://shootout.alioth.debian.org/ | + | This is a Gambit implementation of the [http://shootout.alioth.debian.org/gp4sandbox/benchmark.php?test=fasta&lang=all fasta] benchmark of the [[Programming language shootout|Computer Language Benchmarks Game]]. |
==The program== | ==The program== |
Revision as of 21:56, 22 February 2008
This is a Gambit implementation of the fasta benchmark of the Computer Language Benchmarks Game.
The program
#!gsi-script ;; The Computer Language Benchmarks Game ;; http://shootout.alioth.debian.org/ ;; ;; Derived by Bradley Lucier from the Ikarus variant ;; derived by Michael D. Adams from the Chicken variant by Anthony Borla (declare (standard-bindings)(extended-bindings)(block)(not safe)) (define-macro (unless test . body) `(if (not ,test) (begin ,@body))) (define *alu* (string-append "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")) (define *iub* (list '(#\a . 0.27) '(#\c . 0.12) '(#\g . 0.12) '(#\t . 0.27) '(#\B . 0.02) '(#\D . 0.02) '(#\H . 0.02) '(#\K . 0.02) '(#\M . 0.02) '(#\N . 0.02) '(#\R . 0.02) '(#\S . 0.02) '(#\V . 0.02) '(#\W . 0.02) '(#\Y . 0.02))) (define *homosapien* (list '(#\a . 0.3029549426680) '(#\c . 0.1979883004921) '(#\g . 0.1975473066391) '(#\t . 0.3015094502008))) ;; ------------- (define *line-size* 60) ;; ------------------------------- (define (make-random seed) (let ((ia 3877.0) (ic 29573.) (im 139968.) (last (f64vector (exact->inexact seed))) (result (f64vector 0.))) (lambda () (let* ((advance (fl+ ic (fl* (f64vector-ref last 0) ia))) (next (fl- advance (fl* im (fltruncate (fl/ advance im)))))) (f64vector-set! last 0 next) (f64vector-set! result 0 (fl/ next im)))))) ;; ------------------------------- (define (make-cumulative-table frequency-table) (let ((cumulative 0.0)) (map (lambda (x) (set! cumulative (fl+ cumulative (cdr x))) (cons (car x) cumulative)) frequency-table))) ;; ------------- (define random-next (make-random 42)) (define *segmarker* ">") ;; ------------- (define (select-random cumulative-table) (select-over-threshold (random-next) cumulative-table)) (define (select-over-threshold rvalue table) (if (fl<= (f64vector-ref rvalue 0) (cdar table)) (caar table) (select-over-threshold rvalue (cdr table)))) ;; ------------- (define (repeat-fasta id desc n sequence line-length) (let ((seqlen (string-length sequence)) (out (current-output-port)) (buffer (make-string line-length))) (display (string-append *segmarker* id " " desc "\n") out) (let loop-o ((n n) (k 0)) (unless (fx<= n 0) (let ((m (fxmin n line-length))) (let loop-i ((i 0) (k k)) (if (fx>= i m) (begin (write-substring buffer 0 m) (write-char #\newline out) (loop-o (fx- n line-length) k)) (let ([k (if (fx= k seqlen) 0 k)]) (string-set! buffer i (string-ref sequence k)) (loop-i (fx+ 1 i) (fx+ 1 k)))))))) (force-output out))) ;; ------------- (define (random-fasta id desc n cumulative-table line-length) (let ((out (current-output-port)) (buffer (make-string line-length))) (display (string-append *segmarker* id " " desc "\n") out) (let loop-o ((n n)) (unless (<= n 0) (let ((m (min n line-length))) (let loop-i ((i 0)) (unless (>= i m) (string-set! buffer i (select-random cumulative-table)) (loop-i (fx+ 1 i)))) (write-substring buffer 0 m) (write-char #\newline out) (loop-o (fx- n line-length))))) (force-output out))) ;; ------------------------------- (define (main . args) (let ((n (string->number (car args)))) (repeat-fasta "ONE" "Homo sapiens alu" (* n 2) *alu* *line-size*) (random-fasta "TWO" "IUB ambiguity codes" (* n 3) (make-cumulative-table *iub*) *line-size*) (random-fasta "THREE" "Homo sapiens frequency" (* n 5) (make-cumulative-table *homosapien*) *line-size*) )) ;; -------------------------------
Compiling
gsc fasta
Running
gsi fasta 1000000 > knucleotide-input1000000.txt
The file knucleotide-input1000000.txt is used by k-nucleotide.